Multiple exercises were added to the TypeScript track in this commit.

typescript/nucleotide-count/nucleotide-count.test.ts

@@ -0,0 +1,55 @@
+import { describe, it, expect, xit } from '@jest/globals'
+import { nucleotideCounts } from './nucleotide-count.ts'
+
+describe('count all nucleotides in a strand', () => {
+  it('empty strand', () => {
+    const expected = {
+      A: 0,
+      C: 0,
+      G: 0,
+      T: 0,
+    }
+    expect(nucleotideCounts('')).toEqual(expected)
+  })
+
+  xit('can count one nucleotide in single-character input', () => {
+    const expected = {
+      A: 0,
+      C: 0,
+      G: 1,
+      T: 0,
+    }
+    expect(nucleotideCounts('G')).toEqual(expected)
+  })
+
+  xit('strand with repeated nucleotide', () => {
+    const expected = {
+      A: 0,
+      C: 0,
+      G: 7,
+      T: 0,
+    }
+    expect(nucleotideCounts('GGGGGGG')).toEqual(expected)
+  })
+
+  xit('strand with multiple nucleotides', () => {
+    const expected = {
+      A: 20,
+      C: 12,
+      G: 17,
+      T: 21,
+    }
+    expect(
+      nucleotideCounts(
+        'AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC'
+      )
+    ).toEqual(expected)
+  })
+
+  xit('strand with invalid nucleotides', () => {
+    const expected = 'Invalid nucleotide in strand'
+    expect(() => {
+      nucleotideCounts('AGXXACT')
+    }).toThrow(expected)
+  })
+})