Multiple exercises were added to the TypeScript track in this commit.
This commit is contained in:
@@ -0,0 +1,31 @@
|
||||
{
|
||||
"authors": [
|
||||
"CRivasGomez"
|
||||
],
|
||||
"contributors": [
|
||||
"masters3d",
|
||||
"SleeplessByte"
|
||||
],
|
||||
"files": {
|
||||
"solution": [
|
||||
"nucleotide-count.ts"
|
||||
],
|
||||
"test": [
|
||||
"nucleotide-count.test.ts"
|
||||
],
|
||||
"example": [
|
||||
".meta/proof.ci.ts"
|
||||
]
|
||||
},
|
||||
"blurb": "Given a DNA string, compute how many times each nucleotide occurs in the string.",
|
||||
"custom": {
|
||||
"version.tests.compatibility": "jest-29",
|
||||
"flag.tests.task-per-describe": false,
|
||||
"flag.tests.may-run-long": false,
|
||||
"flag.tests.includes-optional": false,
|
||||
"flag.tests.jest": true,
|
||||
"flag.tests.tstyche": false
|
||||
},
|
||||
"source": "The Calculating DNA Nucleotides_problem at Rosalind",
|
||||
"source_url": "https://rosalind.info/problems/dna/"
|
||||
}
|
||||
@@ -0,0 +1 @@
|
||||
{"track":"typescript","exercise":"nucleotide-count","id":"9369cef256f243b184020257cc055c5f","url":"https://exercism.org/tracks/typescript/exercises/nucleotide-count","handle":"briemens","is_requester":true,"auto_approve":false}
|
||||
@@ -0,0 +1,7 @@
|
||||
{
|
||||
"recommendations": [
|
||||
"arcanis.vscode-zipfs",
|
||||
"dbaeumer.vscode-eslint",
|
||||
"esbenp.prettier-vscode"
|
||||
]
|
||||
}
|
||||
@@ -0,0 +1,7 @@
|
||||
{
|
||||
"cSpell.words": ["exercism"],
|
||||
"search.exclude": {
|
||||
"**/.yarn": true,
|
||||
"**/.pnp.*": true
|
||||
}
|
||||
}
|
||||
@@ -0,0 +1,3 @@
|
||||
compressionLevel: mixed
|
||||
|
||||
enableGlobalCache: true
|
||||
@@ -0,0 +1,50 @@
|
||||
# Help
|
||||
|
||||
## Running the tests
|
||||
|
||||
Before trying to execute the tests, ensure the assignment folder is set-up correctly by following the installation steps, namely `corepack yarn install` and the Editor SDK setup.
|
||||
|
||||
Execute the tests with:
|
||||
|
||||
```bash
|
||||
$ corepack yarn test
|
||||
```
|
||||
|
||||
## Skipped tests
|
||||
|
||||
In the test suites all tests but the first have been skipped.
|
||||
|
||||
Once you get a test passing, you can enable the next one by changing `xit` to `it`.
|
||||
Additionally tests may be grouped using `xdescribe`.
|
||||
Enable the group by changing that to `describe`.
|
||||
Finally, some exercises may have optional tests `it.skip`.
|
||||
Remove `.skip` to execute the optional test.
|
||||
|
||||
## Submitting your solution
|
||||
|
||||
You can submit your solution using the `exercism submit nucleotide-count.ts` command.
|
||||
This command will upload your solution to the Exercism website and print the solution page's URL.
|
||||
|
||||
It's possible to submit an incomplete solution which allows you to:
|
||||
|
||||
- See how others have completed the exercise
|
||||
- Request help from a mentor
|
||||
|
||||
## Need to get help?
|
||||
|
||||
If you'd like help solving the exercise, check the following pages:
|
||||
|
||||
- The [TypeScript track's documentation](https://exercism.org/docs/tracks/typescript)
|
||||
- The [TypeScript track's programming category on the forum](https://forum.exercism.org/c/programming/typescript)
|
||||
- [Exercism's programming category on the forum](https://forum.exercism.org/c/programming/5)
|
||||
- The [Frequently Asked Questions](https://exercism.org/docs/using/faqs)
|
||||
|
||||
Should those resources not suffice, you could submit your (incomplete) solution to request mentoring.
|
||||
|
||||
To get help if you're having trouble, you can use one of the following resources:
|
||||
|
||||
- [TypeScript QuickStart](https://www.typescriptlang.org/docs/handbook/release-notes/overview.html)
|
||||
- [ECMAScript 2015 Language Specification](https://www.ecma-international.org/wp-content/uploads/ECMA-262_6th_edition_june_2015.pdf) (pdf)
|
||||
- [Mozilla JavaScript Reference](https://developer.mozilla.org/en-US/docs/Web/JavaScript/Reference)
|
||||
- [/r/typescript](https://www.reddit.com/r/typescript) is the TypeScript subreddit.
|
||||
- [StackOverflow](https://stackoverflow.com/questions/tagged/typescript) can be used to search for your problem and see if it has been answered already. You can also ask and answer questions.
|
||||
@@ -0,0 +1,43 @@
|
||||
# Nucleotide Count
|
||||
|
||||
Welcome to Nucleotide Count on Exercism's TypeScript Track.
|
||||
If you need help running the tests or submitting your code, check out `HELP.md`.
|
||||
|
||||
## Instructions
|
||||
|
||||
Each of us inherits from our biological parents a set of chemical instructions known as DNA that influence how our bodies are constructed.
|
||||
All known life depends on DNA!
|
||||
|
||||
> Note: You do not need to understand anything about nucleotides or DNA to complete this exercise.
|
||||
|
||||
DNA is a long chain of other chemicals and the most important are the four nucleotides, adenine, cytosine, guanine and thymine.
|
||||
A single DNA chain can contain billions of these four nucleotides and the order in which they occur is important!
|
||||
We call the order of these nucleotides in a bit of DNA a "DNA sequence".
|
||||
|
||||
We represent a DNA sequence as an ordered collection of these four nucleotides and a common way to do that is with a string of characters such as "ATTACG" for a DNA sequence of 6 nucleotides.
|
||||
'A' for adenine, 'C' for cytosine, 'G' for guanine, and 'T' for thymine.
|
||||
|
||||
Given a string representing a DNA sequence, count how many of each nucleotide is present.
|
||||
If the string contains characters that aren't A, C, G, or T then it is invalid and you should signal an error.
|
||||
|
||||
For example:
|
||||
|
||||
```text
|
||||
"GATTACA" -> 'A': 3, 'C': 1, 'G': 1, 'T': 2
|
||||
"INVALID" -> error
|
||||
```
|
||||
|
||||
## Source
|
||||
|
||||
### Created by
|
||||
|
||||
- @CRivasGomez
|
||||
|
||||
### Contributed to by
|
||||
|
||||
- @masters3d
|
||||
- @SleeplessByte
|
||||
|
||||
### Based on
|
||||
|
||||
The Calculating DNA Nucleotides_problem at Rosalind - https://rosalind.info/problems/dna/
|
||||
@@ -0,0 +1,5 @@
|
||||
module.exports = {
|
||||
// eslint-disable-next-line @typescript-eslint/no-require-imports
|
||||
presets: [[require('@exercism/babel-preset-typescript'), { corejs: '3.38' }]],
|
||||
plugins: [],
|
||||
}
|
||||
@@ -0,0 +1,26 @@
|
||||
// @ts-check
|
||||
|
||||
import tsEslint from 'typescript-eslint'
|
||||
import config from '@exercism/eslint-config-typescript'
|
||||
import maintainersConfig from '@exercism/eslint-config-typescript/maintainers.mjs'
|
||||
|
||||
export default [
|
||||
...tsEslint.config(...config, {
|
||||
files: ['.meta/proof.ci.ts', '.meta/exemplar.ts', '*.test.ts'],
|
||||
extends: maintainersConfig,
|
||||
}),
|
||||
{
|
||||
ignores: [
|
||||
// # Protected or generated
|
||||
'.git/**/*',
|
||||
'.vscode/**/*',
|
||||
|
||||
//# When using npm
|
||||
'node_modules/**/*',
|
||||
|
||||
// # Configuration files
|
||||
'babel.config.cjs',
|
||||
'jest.config.cjs',
|
||||
],
|
||||
},
|
||||
]
|
||||
@@ -0,0 +1,22 @@
|
||||
module.exports = {
|
||||
verbose: true,
|
||||
projects: ['<rootDir>'],
|
||||
testMatch: [
|
||||
'**/__tests__/**/*.[jt]s?(x)',
|
||||
'**/test/**/*.[jt]s?(x)',
|
||||
'**/?(*.)+(spec|test).[jt]s?(x)',
|
||||
],
|
||||
testPathIgnorePatterns: [
|
||||
'/(?:production_)?node_modules/',
|
||||
'.d.ts$',
|
||||
'<rootDir>/test/fixtures',
|
||||
'<rootDir>/test/helpers',
|
||||
'__mocks__',
|
||||
],
|
||||
transform: {
|
||||
'^.+\\.[jt]sx?$': 'babel-jest',
|
||||
},
|
||||
moduleNameMapper: {
|
||||
'^(\\.\\/.+)\\.js$': '$1',
|
||||
},
|
||||
}
|
||||
@@ -0,0 +1,55 @@
|
||||
import { describe, it, expect, xit } from '@jest/globals'
|
||||
import { nucleotideCounts } from './nucleotide-count.ts'
|
||||
|
||||
describe('count all nucleotides in a strand', () => {
|
||||
it('empty strand', () => {
|
||||
const expected = {
|
||||
A: 0,
|
||||
C: 0,
|
||||
G: 0,
|
||||
T: 0,
|
||||
}
|
||||
expect(nucleotideCounts('')).toEqual(expected)
|
||||
})
|
||||
|
||||
xit('can count one nucleotide in single-character input', () => {
|
||||
const expected = {
|
||||
A: 0,
|
||||
C: 0,
|
||||
G: 1,
|
||||
T: 0,
|
||||
}
|
||||
expect(nucleotideCounts('G')).toEqual(expected)
|
||||
})
|
||||
|
||||
xit('strand with repeated nucleotide', () => {
|
||||
const expected = {
|
||||
A: 0,
|
||||
C: 0,
|
||||
G: 7,
|
||||
T: 0,
|
||||
}
|
||||
expect(nucleotideCounts('GGGGGGG')).toEqual(expected)
|
||||
})
|
||||
|
||||
xit('strand with multiple nucleotides', () => {
|
||||
const expected = {
|
||||
A: 20,
|
||||
C: 12,
|
||||
G: 17,
|
||||
T: 21,
|
||||
}
|
||||
expect(
|
||||
nucleotideCounts(
|
||||
'AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC'
|
||||
)
|
||||
).toEqual(expected)
|
||||
})
|
||||
|
||||
xit('strand with invalid nucleotides', () => {
|
||||
const expected = 'Invalid nucleotide in strand'
|
||||
expect(() => {
|
||||
nucleotideCounts('AGXXACT')
|
||||
}).toThrow(expected)
|
||||
})
|
||||
})
|
||||
@@ -0,0 +1,3 @@
|
||||
export function nucleotideCounts(/* Parameters go here */) {
|
||||
throw new Error('Remove this statement and implement this function')
|
||||
}
|
||||
@@ -0,0 +1,38 @@
|
||||
{
|
||||
"name": "@exercism/typescript-nucleotide-count",
|
||||
"version": "1.0.0",
|
||||
"description": "Exercism exercises in Typescript.",
|
||||
"private": true,
|
||||
"repository": {
|
||||
"type": "git",
|
||||
"url": "https://github.com/exercism/typescript"
|
||||
},
|
||||
"type": "module",
|
||||
"engines": {
|
||||
"node": "^18.16.0 || >=20.0.0"
|
||||
},
|
||||
"devDependencies": {
|
||||
"@exercism/babel-preset-typescript": "^0.6.0",
|
||||
"@exercism/eslint-config-typescript": "^0.8.0",
|
||||
"@jest/globals": "^29.7.0",
|
||||
"@types/node": "~22.7.6",
|
||||
"babel-jest": "^29.7.0",
|
||||
"core-js": "~3.38.1",
|
||||
"eslint": "^9.12.0",
|
||||
"expect": "^29.7.0",
|
||||
"jest": "^29.7.0",
|
||||
"prettier": "^3.3.3",
|
||||
"tstyche": "^2.1.1",
|
||||
"typescript": "~5.6.3",
|
||||
"typescript-eslint": "^8.10.0"
|
||||
},
|
||||
"scripts": {
|
||||
"test": "corepack yarn node test-runner.mjs",
|
||||
"test:types": "corepack yarn tstyche",
|
||||
"test:implementation": "corepack yarn jest --no-cache --passWithNoTests",
|
||||
"lint": "corepack yarn lint:types && corepack yarn lint:ci",
|
||||
"lint:types": "corepack yarn tsc --noEmit -p .",
|
||||
"lint:ci": "corepack yarn eslint . --ext .tsx,.ts"
|
||||
},
|
||||
"packageManager": "yarn@4.5.1"
|
||||
}
|
||||
@@ -0,0 +1,111 @@
|
||||
#!/usr/bin/env node
|
||||
|
||||
/**
|
||||
* 👋🏽 Hello there reader,
|
||||
*
|
||||
* It looks like you are working on this solution using the Exercism CLI and
|
||||
* not the online editor. That's great! The file you are looking at executes
|
||||
* the various steps the online test-runner also takes.
|
||||
*
|
||||
* @see https://github.com/exercism/typescript-test-runner
|
||||
*
|
||||
* TypeScript track exercises generally consist of at least two out of three
|
||||
* types of tests to run.
|
||||
*
|
||||
* 1. tsc, the TypeScript compiler. This tests if the TypeScript code is valid
|
||||
* 2. tstyche, static analysis tests to see if the types used are expected
|
||||
* 3. jest, runtime implementation tests to see if the solution is correct
|
||||
*
|
||||
* If one of these three fails, this script terminates with -1, -2, or -3
|
||||
* respectively. If it succeeds, it terminates with exit code 0.
|
||||
*
|
||||
* @note you need corepack (bundled with node LTS) enabled in order for this
|
||||
* test runner to work as expected. Follow the installation and test
|
||||
* instructions if you see errors about corepack or pnp.
|
||||
*/
|
||||
|
||||
import { execSync } from 'node:child_process'
|
||||
import { existsSync, readFileSync } from 'node:fs'
|
||||
import { exit } from 'node:process'
|
||||
import { URL } from 'node:url'
|
||||
|
||||
/**
|
||||
* Before executing any tests, the test runner attempts to find the
|
||||
* exercise config.json file which has metadata about which types of tests
|
||||
* to run for this solution.
|
||||
*/
|
||||
const metaDirectory = new URL('./.meta/', import.meta.url)
|
||||
const exercismDirectory = new URL('./.exercism/', import.meta.url)
|
||||
const configDirectory = existsSync(metaDirectory)
|
||||
? metaDirectory
|
||||
: existsSync(exercismDirectory)
|
||||
? exercismDirectory
|
||||
: null
|
||||
|
||||
if (configDirectory === null) {
|
||||
throw new Error(
|
||||
'Expected .meta or .exercism directory to exist, but I cannot find it.'
|
||||
)
|
||||
}
|
||||
|
||||
const configFile = new URL('./config.json', configDirectory)
|
||||
if (!existsSync(configFile)) {
|
||||
throw new Error('Expected config.json to exist at ' + configFile.toString())
|
||||
}
|
||||
|
||||
// Experimental: import config from './config.json' with { type: 'json' }
|
||||
/** @type {import('./config.json') } */
|
||||
const config = JSON.parse(readFileSync(configFile))
|
||||
|
||||
const jest = !config.custom || config.custom['flag.tests.jest']
|
||||
const tstyche = config.custom?.['flag.tests.tstyche']
|
||||
console.log(
|
||||
`[tests] tsc: ✅, tstyche: ${tstyche ? '✅' : '❌'}, jest: ${jest ? '✅' : '❌'}, `
|
||||
)
|
||||
|
||||
/**
|
||||
* 1. tsc: the typescript compiler
|
||||
*/
|
||||
try {
|
||||
console.log('[tests] tsc (compile)')
|
||||
execSync('corepack yarn lint:types', {
|
||||
stdio: 'inherit',
|
||||
cwd: process.cwd(),
|
||||
})
|
||||
} catch {
|
||||
exit(-1)
|
||||
}
|
||||
|
||||
/**
|
||||
* 2. tstyche: type tests
|
||||
*/
|
||||
if (tstyche) {
|
||||
try {
|
||||
console.log('[tests] tstyche (type tests)')
|
||||
execSync('corepack yarn test:types', {
|
||||
stdio: 'inherit',
|
||||
cwd: process.cwd(),
|
||||
})
|
||||
} catch {
|
||||
exit(-2)
|
||||
}
|
||||
}
|
||||
|
||||
/**
|
||||
* 3. jest: implementation tests
|
||||
*/
|
||||
if (jest) {
|
||||
try {
|
||||
console.log('[tests] tstyche (implementation tests)')
|
||||
execSync('corepack yarn test:implementation', {
|
||||
stdio: 'inherit',
|
||||
cwd: process.cwd(),
|
||||
})
|
||||
} catch {
|
||||
exit(-3)
|
||||
}
|
||||
}
|
||||
|
||||
/**
|
||||
* Done! 🥳
|
||||
*/
|
||||
@@ -0,0 +1,38 @@
|
||||
{
|
||||
"display": "Configuration for Exercism TypeScript Exercises",
|
||||
"compilerOptions": {
|
||||
// Allows you to use the newest syntax, and have access to console.log
|
||||
// https://www.typescriptlang.org/tsconfig#lib
|
||||
"lib": ["ES2020", "dom"],
|
||||
// Make sure typescript is configured to output ESM
|
||||
// https://gist.github.com/sindresorhus/a39789f98801d908bbc7ff3ecc99d99c#how-can-i-make-my-typescript-project-output-esm
|
||||
"module": "Node16",
|
||||
// Since this project is using babel, TypeScript may target something very
|
||||
// high, and babel will make sure it runs on your local Node version.
|
||||
// https://babeljs.io/docs/en/
|
||||
"target": "ES2020", // ESLint doesn't support this yet: "es2022",
|
||||
|
||||
"strict": true,
|
||||
"esModuleInterop": true,
|
||||
"skipLibCheck": true,
|
||||
"forceConsistentCasingInFileNames": true,
|
||||
|
||||
// Because jest-resolve isn't like node resolve, the absolute path must be .ts
|
||||
"allowImportingTsExtensions": true,
|
||||
"noEmit": true,
|
||||
|
||||
// Because we'll be using babel: ensure that Babel can safely transpile
|
||||
// files in the TypeScript project.
|
||||
//
|
||||
// https://babeljs.io/docs/en/babel-plugin-transform-typescript/#caveats
|
||||
"isolatedModules": true
|
||||
},
|
||||
"include": [
|
||||
"*.ts",
|
||||
"*.tsx",
|
||||
".meta/*.ts",
|
||||
".meta/*.tsx",
|
||||
"__typetests__/*.tst.ts"
|
||||
],
|
||||
"exclude": ["node_modules"]
|
||||
}
|
||||
Reference in New Issue
Block a user